superscript ii reverse transcriptase first strand cdna synthesis kit (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher superscript ii reverse transcriptase first strand cdna synthesis kit
Superscript Ii Reverse Transcriptase First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscript+ii+reverse+transcriptase+first+strand+cdna+synthesis+kit/high+capacity+cdna+reverse+transcription+kit/10__7554_slash_elife__79833-231-79-88
Average 90 stars, based on 1 article reviews

superscript ii reverse transcriptase first strand cdna synthesis kit - by Bioz Stars, 2026-09

90/100 stars

Images

Generated:

Article Title: Distribution and development of molecularly distinct perineuronal nets in visual thalamus
Article Snippet: Sez6l (clone ID 30362651), Syt1 (clone ID 5363062) cDNAs were obtained GE Dharmacon. .. Gad1 cDNA (nucleotides 1099–2081) was generated using Superscript II Reverse Transcriptase First Strand cDNA Synthesis kit (# 18064014, Invitrogen, La Jolla, CA) according to the manufacturer manual, amplified by PCR using following primers: F: TGTGCCCAAACTGGTCCT; R: TGGCCGATGATTCTGGTT (Integrated DNA Technologies), gel purified, and then cloned into a pGEM-T Easy Vector using pGEM-T Easy Vector kit, (cat # A1360, Promega, Madison, WI) according to the kit manual. ..

Article Title: Sonic hedgehog-dependent recruitment of GABAergic interneurons into the developing visual thalamus
Article Snippet: Plasmids carrying Fgf15 (Cat#MMM1013-202768318) were purchased from GE Dharmacon. .. Gad1 1 Kb cDNA (corresponding to nucleotides 1099-2081) and Gja1 1.1 Kb cDNA (corresponding to nucleotides 714-1854) were generated using SuperScript II Reverse Transcriptase First Strand cDNA Synthesis kit (Invitrogen, Cat18064014) and the manufacturer’s protocol. .. The information for the sequence of cloning primers is in the key resources table. cDNA was then cloned into the pGEM-T Easy vector (Promega, Cat#A1360).

Article Title: Diverse GABAergic neurons organize into subtype-specific sublaminae in the ventral lateral geniculate nucleus
Article Snippet: .. Gad1 (Gad1-F: TGTGCCCAAACTGGTCCT; Gad1-R: TGGCCGATGATTCTGGTT; NM_001312900.1; nucleotides 1099-2081), Lypd1 (Lypd1-F: AAGGGAGTCTTTTTGTTCCCTC; Lypd1-R: TACAACGTGTCCTCTCAGCAGT; NM_145100.4; nucleotides 849-1522), Arx (Arx-F: CTGAGGCTCAAGGCTAAGGAG; Arx-R: GGTTTCCGAAGCCTCTACAGTT; NM_007492.4; nucleotides 1830-2729), Ecel1 (Ecel1-F: CGCGCTCTTCTCGCTTAC; Ecel1-R: GGAGGAGCCACGAGGATT; NM_001277925.1; nucleotides 942-1895), Nxph1 (Nxph1-F: ATAGGACAGGGCTGTCACCTTA; Nxph1-R: TTACTGAGAACAAGCTCCTCCC; NM_008751.5; nucleotides 1095-1695), Spp1 (Spp1-F: AATCTCCTTGCGCCACAG; Spp1-R: TGGCCGTTTGCATTTCTT; NM_001204201.1; nucleotides 309-1263), Sst (NM_009215.1; nucleotides 7-550), and Penk (Penk-F: TTCCTGAGGCTTTGCACC; Penk-R: TCACTGCTGGAAAAGGGC; NM_001002927.3; nucleotides 312-1111) cDNAs were generated using Superscript II Reverse Transcriptase First Strand cDNA Synthesis kit (#18064014, Invitrogen) according to the manufacturer manual, amplified by PCR using primers designed for the above gene fragments, gel purified, and then cloned into a pGEM-T Easy Vector using pGEM-T Easy Vector kit, (#A1360, Promega) according to the kit manual. .. Anti-sense riboprobes against target genes were synthesized from 5 μg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312, Ambion) according to the kit manual.

Article Title: Diverse GABAergic neurons organize into subtype‐specific sublaminae in the ventral lateral geniculate nucleus
Article Snippet: .. Gad1 (Gad1‐F: TGTGCCCAAACTGGTCCT; Gad1‐R: TGGCCGATGATTCTGGTT; NM_001312900.1; nucleotides 1099–2081), Lypd1 (Lypd1‐F: AAGGGAGTCTTTTTGTTCCCTC; Lypd1‐R: TACAACGTGTCCTCTCAGCAGT; NM_145100.4; nucleotides 849–1522), Arx (Arx‐F: CTGAGGCTCAAGGCTAAGGAG; Arx‐R: GGTTTCCGAAGCCTCTACAGTT; NM_007492.4; nucleotides 1830–2729), Ecel1 (Ecel1‐F: CGCGCTCTTCTCGCTTAC; Ecel1‐R: GGAGGAGCCACGAGGATT; NM_001277925.1; nucleotides 942–1895), Nxph1 (Nxph1‐F: ATAGGACAGGGCTGTCACCTTA; Nxph1‐R: TTACTGAGAACAAGCTCCTCCC; NM_008751.5; nucleotides 1095–1695), Spp1 (Spp1‐F: AATCTCCTTGCGCCACAG; Spp1‐R: TGGCCGTTTGCATTTCTT; NM_001204201.1; nucleotides 309–1263), Sst (NM_009215.1; nucleotides 7–550), and Penk (Penk‐F: TTCCTGAGGCTTTGCACC; Penk‐R: TCACTGCTGGAAAAGGGC; NM_001002927.3; nucleotides 312–1111) cDNAs were generated using Superscript II Reverse Transcriptase First Strand cDNA Synthesis kit (#18064014, Invitrogen) according to the manufacturer manual, amplified by PCR using primers designed for the above gene fragments, gel purified, and then cloned into a pGEM‐T Easy Vector using pGEM‐T Easy Vector kit, (#A1360, Promega) according to the kit manual. .. Anti‐sense riboprobes against target genes were synthesized from 5 μg linearized plasmids using digoxigenin‐(DIG) or fluorescein‐labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312, Ambion) according to the kit manual.

Reverse Transcription:

Article Title: Sonic hedgehog-dependent recruitment of GABAergic interneurons into the developing visual thalamus
Article Snippet: Peptide, recombinant protein , CTB (Recombinant), Alexa Fluor 555 Conjugate , Thermo Fisher Scientific , CAT#C34776 , . .. Commercial assay, kit , SuperScript II Reverse Transcriptase First Strand cDNA Synthesis kit , Invitrogen , Cat#18064014 , . .. Commercial assay, kit , pGEM-T Easy Vector Systems , Promega , Cat#A1360 , .

Article Title: Paracrine Role for Somatostatin Interneurons in the Assembly of Perisomatic Inhibitory Synapses
Article Snippet: VECTASHIELD mounting medium (catalog #H-1000) was from Vector Laboratories. .. The Invitrogen Superscript II Reverse Transcriptase First Strand cDNA Synthesis kit (catalog #18064014) was from Thermo Fisher Scientific. .. The Aurum Total RNA Fatty and Fibrous Tissue Kit (catalog #7326870) was from Bio-Rad. pGEM-T Easy Vector Systems (catalog #A1360) was from Promega.

cDNA Synthesis:

Amplification:

Polymerase Chain Reaction:

Purification:

Clone Assay:

other:

Article Title: Sonic hedgehog-dependent recruitment of GABAergic interneurons into the developing visual thalamus
Article Snippet: Garcia, Drexel University JAX #007913, #007914; RRID: IMSR_JAX:007913, IMSR_ JAX:007914 Peptide, recombinant protein Fluorescein RNA Labeling Mix Roche Cat#11685619910 Peptide, recombinant protein DIG RNA Labeling Mix Roche Cat#11277073910 Peptide, recombinant protein SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat#18064022 Peptide, recombinant protein Cholera Toxin Subunit B (CTB, Recombinant), Alexa Fluor 488 Conjugate Thermo Fisher Scientific CAT#C22841 Peptide, recombinant protein Tamoxifen Sigma CAT#T5648- 1G Peptide, recombinant protein CTB (Recombinant), Alexa Fluor 555 Conjugate Thermo Fisher Scientific CAT#C34776 Commercial assay, kit SuperScript II Reverse Transcriptase First Strand cDNA Synthesis kit Invitrogen Cat#18064014 Commercial assay, kit pGEM- T Easy Vector Systems Promega Cat#A1360 Commercial assay, kit MAXIscript in vitro Transcription Kit Ambion Cat#AM1312 Commercial assay, kit Tyramide Signal Amplification system PerkinElmer Cat#NEL753001KT Commercial assay, kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#1725124 Commercial assay, kit Bio- Rad Total RNA Extraction from Fibrous and Fatty Tissue kit Bio- Rad Cat#7326870 Commercial assay, kit RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics (ACD) Cat#323100 Other RNAseq datasets for the developing mouse dLGN and vLGN DOI: https://doi.org/ 10.7554/eLife.33498.006 Monavarfeshani et al., 2018 Other Single- cell RNAseq dataset for RGC subtypes DOI: https://doi.org/ 10.1038/s41467-018-05134-3 Accession # GSE115404 Rheaume et al., 2018 Other Single- cell RNAseq dataset for RGCs at various ages DOI: https://doi.org/ 10.7554/eLife.73809 Accession # GSE185671 Shekhar et al., 2022 Somaiya et al. eLife 2022;11:e79833.

Review